| Research Article | ||
Open Vet. J.. 2026; 16(4): 2552-2560 Open Veterinary Journal, (2026), Vol. 16(4): 2552-2560 Research Article Assessment of Salmonella spp. Lipopolysaccharide immunogenicity for candidate vaccine developmentHusain Ali Khalaf1* and Alaa Abdulaziz Abed21Department of Veterinary Microbiology, College of Veterinary Medicine, University of Al-Qadisiyah, Al Diwaniyah, Iraq 2Department of Pathology and Poultry Diseases, College of Veterinary Medicine, University of Al-Qadisiyah, Al Diwaniyah City, Iraq *Corresponding Author: Husain Ali Khalaf. Department of Veterinary Microbiology, College of Veterinary Medicine, University of Al-Qadisiyah, Al Diwaniyah, Iraq. Email: vet.post23.30 [at] qu.edu.iq Submitted: 15/11/2025 Revised: 24/02/2026 Accepted: 15/03/2026 Published: XX/XX/XXXX © 2025 Open Veterinary Journal
ABSTRACTBackground: Salmonella infections impose considerable global health challenges, mostly due to the variable serovar efficacy of existing vaccines. Salmonella’s lipopolysaccharide (LPS), an integral surface component that potently stimulates and activates the innate immune system, is a prime candidate for the development of universal vaccine formulations. Evaluating the immunogenic potential of LPS requires meticulous and complete molecular typing and characterization of the Salmonella subspecies. Aim: This study aimed to isolate, purify, and characterize LPS from Salmonella spp. isolates, confirm the bacterial strains through molecular phylogenetic analysis, evaluate the immune responses induced by LPS in host models, and assess their potential as a candidate for vaccine development. Methods: We identified clinical isolates using biochemical and molecular (sequence-based) tools. LPS was extracted and purified using the hot phenol-water method. The molecular integrity of LPS and the presence of a ladder O-antigen were detected by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Experimental animals were immunized with LPS, and their immune responses were evaluated by estimating serum cytokine [TNF -α, Interleukin-6 (IL-6), Interleukin-1 beta (IL-1β), Interferon-gamma (IFN-γ)] levels, IgM and IgG antibody responses, and challenge protection rate. Descriptive statistics were performed, and p < 0.05 was considered statistically significant. Results: Sequence alignment and phylogenetic analyses confirmed that the isolates were Salmonella spp. with close genetic distances to the reference strains. SDS-PAGE indicated a crystal clear and smooth-type LPS profile with clear O-antigens. LPS immunization effectively provoked significant levels of tumor necrosis factor-alpha, IL-6, IL-1β, and IFN-γ (p < 0.01). Particular to LPS, anti-IgM and IgG antibody levels were vividly increased (p < 0.001). Challenge experiments demonstrated that prolonged survival and decreased clinical signs were evident in LPS-immunized groups. Conclusion: The extracted LPS was predictably immunogenic, exhibiting robust innate and adaptive immune responses, and thus could be envisioned as a novel candidate for the development of Salmonella vaccines. Keywords: Cytokines, Immunogenicity, Lipopolysaccharide, Phylogeny, Salmonella. IntroductionThe increasing incidence of antimicrobial resistance in gram-negative pathogens has highlighted the increasing importance of alternative preventive measures, such as the development of vaccines against LPS and other conserved molecular targets. Owing to its function in virulence, immune stimulation, and host–pathogen interaction of the bacteria, it has become a strategic target for vaccine development. Studies on Klebsiella pneumoniae have demonstrated the protective efficacy of LPS-targeting antibodies, especially against hypervirulent and resistant strains (Miller et al., 2024). Moreover, Cross (2023) stated that one of the surface antigens preserved across a number of Gram-negative bacteria is LPS, and this should render it useful for vaccine development, especially now that the antimicrobial pipeline is shallow (Asadi Karam et al., 2019). Advancements in glycoconjugate engineering have enhanced the development of LPS-based vaccines. Zhu et al. (2021) noted how modern techniques have brought back interest in LPS glycoconjugates for multivalent vaccines despite the difficulties caused by lipid A toxicity and the expensive O-antigen. This development is consistent with the general principles of glycovaccinology in which the surface carbohydrates are the optimal targets for vaccine development because of their accessibility and immunogenic potential (Hulbert et al., 2023). Outer membrane vesicles (OMVs), which are also LPS-enriched and derived from gram-negative bacteria, have become popular in immunization as they are versatile. Klebsiella pneumoniae and Salmonella OMVs provoke robust protective immunity while offering a flexible platform for antigen display (Haque et al., 2021; Garling et al., 2025; Li et al., 2025). All of which contributes to why OMV-associated LPS and purified LPS are the primary targets for potential novel vaccines. Building on the immunological mechanisms that drive LPS-induced protection is vital for the development of effective vaccines. LPS is known for its association with and potent activation of the innate immunity receptor (TLR4), which activates the innate immune system and modifies the adaptive immune system to produce changes that are subsequently reactivated. Changes in innate immune system activation, known as trained immunity, induced by some microbial constituents, including lipopolysaccharide, increase macrophage and endothelial activation, resulting in a more pronounced response following subsequent exposure (Drummer et al., 2021). This is relevant for vaccines aimed at infectious diseases and for autoimmune and metabolic diseases where an overactive innate immune response is thought to play a harmful role (Mora et al., 2023). The properties of LPS and some LPS are also important in the context of vaccine preparation as potent innate immune system priming agents. The AS01 adjuvanted vaccine is a good example of the application of this principle, where Monophosphoryl Lipid A, a less active LPS, is combined with vaccines to promote a protective Th1-dominant response against most intracellular pathogens (Roman et al., 2024). The same type of immunological effects is reported with the use of Hsp70-based adjuvants, which are known to improve vaccine effectiveness by increasing antigen presentation and modulating the immune system to induce an inflammation response that is needed for the vaccine to be effective (Liu et al., 2025). The importance of LPS antigenic variation is not limited to gastrointestinal and respiratory pathogens. The agent of Q fever, Coxiella burnetii, has a particular LPS phase variation that affects its virulence and presents challenges in developing vaccines for the disease (España et al., 2020). Hence, understanding the structural diversity of LPS in the other members of this genus is important (Yadav and Awasthi, 2023). Finally, the targeting of gonococcal LOS has provided evidence for the design, immunological significance, and ease of application of carbohydrate-centered vaccine approaches to pathogens with extensive antigenic diversity and few treatment options (Gulati et al., 2019). Taken together, such evidence demonstrates that LPS and other membrane carbohydrates are credible and thoroughly researched targets for the control of a plethora of bacterial infections, including Salmonella, where LPS is a major antigen required for protective immunity. This study aimed to isolate Salmonella spp. LPS, characterize and purify it, determine the identity of strains by molecular (sequence) phylogenetic analysis, determine LPS immune reactions in the hosts, and assess the LPS immunogenicity potential as a vaccine. Materials and MethodsIsolation and identification of bacteriaA total of 35 Salmonella isolates were initially recovered from stool samples (Al-Diwaniyah Teaching Hospital, Iraq) and confirmed using standard bacteriological and biochemical methods. From these, five isolates were subjected to molecular characterization, LPS, and downstream experimental analyses based on serotype diversity and phenotypic characteristics. The samples obtained from the clinic were cultured on XLD, MacConkey, and SS agar and incubated at 37°C for 24 hours. Colonies that did not ferment lactose and were potentially Salmonella were further isolated and examined. biochemical analysis usingTriple Sugar Iron agar, Sulfide–Indole–Motility medium, citrate, urease, and oxidase methods. Pure isolate glycerol stocks were kept at −80°C until they were needed for further molecular analysis and LPS extraction. Extraction of DNA, polymerase chain reaction (PCR), and sequence analysisGenomic DNA was obtained from 24 hour-old cultures using the boiling lysis method. PCR amplification was performed using pre-determined primers and standard cycling conditions with commercial PCR Master Mix (2 × DreamTaq Green PCR Master Mix, Thermo Fisher Scientific, USA). PCR amplification of the target gene was performed using specific forward and reverse primers under optimized cycling conditions: initial denaturation at 95°C for 5 minutes, followed by 35 cycles of 95°C for 30 seconds, 55°C–58°C for 30 seconds, and 72°C for 45 seconds, with a final extension at 72°C for 7 minutes. Bidirectional sequencing was then performed on the obtained amplicons. The obtained sequences were aligned using Clustal Omega to authenticate the sequences and ascertain nucleotide differences. The uploaded alignment image was used to verify the existence of and measure the differences in the conserved sequences to confirm the existence of genetic differences in the isolates before vaccine preparation. PCR amplification focused on the invA gene, a conserved gene in the Salmonella enterica virulence gene repertoire. The primers used were GTGAAATTATCGCCACGTTCGGGCAA (forward) and TCATCGCACCGTCAAAGGAACC (reverse), looking for a product size of 284 bp. IDT (USA) synthesized the primers. The PCR reaction was set for a volume of 25 µl and contained 12.5 µl of 2 × DreamTaq Green PCR Master Mix (Thermo Fisher, USA), 0.5 µM of each primer, 2 µl of the template DNA, and nuclease-free water. The PCR cycle was set with an initial denaturation of 95°C for 5 minutes, followed by 35 cycles of denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, and increasing the temperature to 72°C for 45 seconds. The final extension was set to 72°C for 7 minutes. Building phylogenetic treesUsing the MUSCLE package, we performed a sequence alignment that we later used to create a maximum likelihood phylogenetic tree (Tamura–Nei model, 1,000 bootstraps). The uploaded phylogenetic tree (tree.pdf) was observed to evaluate the distinct clustering of each reference Salmonella strain. We concluded that the phylogenetic traces to the isolates were valid and that they were of close evolutionary relationship, justifying LPS-based immunization. Extraction and purification of LPSLPS extraction was performed using the conventional hot phenol–water procedure. We collected the bacterial pellets and added 90% phenol at a boiling temperature of 68°C. After collection, the aqueous phases were dialyzed to remove phenol and any small contaminants, and DNase, RNase, and proteinase K were added before lyophilization. LPS yield was spectrophotometrically calculated, and purity was characterized. LPS were isolated using the hot phenol-water method. For this procedure, 1 g (wet weight) of the bacterial sample was re-suspended in distilled water, and phenol was added in a 1:1 (v/w) ratio and brought to 68°C for 30 minutes with constant stirring. After a 20-minute centrifugation step at 10,000 × g, the supernatant was isolated. The LPS was purified through 72 hours of dialysis against distilled water. The purity of the extracted LPS was evaluated by measuring the absorbance at 260 and 280 nm and determined to be free of contaminating proteins and nucleic acids by SDS-PAGE and the absence of absorbance at 260 nm. The purity of the extracted LPS was confirmed by SDS-PAGE analysis, which revealed characteristic ladder-like banding consistent with smooth-type LPS. The absence of protein and nucleic acid contamination was verified by A260/A280 ratios and lack of protein bands. Confirmation of the bands and SDS-PAGE resultsWe purified the LPS sample for electrophoresis on SDS-PAGE and used 15% resolving gel. The samples were heated and mixed with Laemmli buffer before gel electrophoresis and reacted with silver stain to visualize O-antigen laddering. The LPS vaccine was prepared in accordance with the Food and Drug Administration regulations. Each batch of purified LPS was aseptically diluted in sterile saline, and a measured volume of aluminum hydroxide (alum) adjuvant was added. Each premeasured dose to be injected was checked for LPS endotoxin level and sterility. Each preparation was dispensed into sterile, endotoxin-free vials and maintained at 4°C until administration. Experimental animals and the vaccination programSeveral healthy male BALB/c mice were divided into their respective control and vaccinated cohorts. Each member of the vaccinated cohort was intramuscularly injected with LPS vaccine on day 0 and boosters on days 14 and 28, whereas members of the control cohort received saline with alum only. Blood was taken weekly to monitor and record the animals’ cytokines and antibodies, and the animals were observed every day for any changes in their standard behavior and health status and were kept within standard ethical constraints. BALB/c mice (6–8 weeks old), n=6 for each group, were acquired from the institutional animal facility and housed under standard conditions. The animals were divided into two groups: the control and LPS-treated groups. LPS was administered intraperitoneally at a dose of 10 g per mouse in 200 l sterile phosphate-buffered saline. Measurement of cytokinesBlood levels of tumor necrosis factor-alpha (TNF-α), Interleukin-6 (IL-6), Interleukin-1 beta (IL-1β), and Interferon-gamma (IFN-γ) were quantified using standard enzyme-linked immunosorbent assay kits. Each assay was performed in duplicate, and the absorbance was measured at 450 nm. Cytokine concentrations were calculated using standard curves, while differences between the vaccinated and control groups were analyzed with analysis of variance (ANOVA) with significance set at p < 0.05. Antibody response (IgM and IgG)Anti-LPS IgM and IgG concentrations were obtained from a 96-well microplate where each well was coated with LPS and followed by an indirect enzyme-linked immunosorbent assay from Elabscience Biotechnology Co., Ltd. (Houston, TX, USA). Serum samples were diluted and added to each well, followed by HRP-conjugated secondary antibodies. Color was developed using the TMB substrate and endpoint i. Challenge and protection assessmentAnimals were challenged with a virulent dose of Salmonella 4 weeks after the last booster. The survival and clinical signs of the animals were monitored, and the bacterial load in the target organs was assessed. Protection was assessed by comparing the challenged and unchallenged groups. In the challenge experiments, the mice were orally infected with S. enterica at a dose of 1 × 108 CFU. Bacterial loads were measured by plating serially diluted tissue homogenates on selective agar. Results are expressed as CFU per gram of tissue. Salmonella enterica serovar Typhimurium was used for the challenge. Statistical analysisExperiments were performed in triplicate. Data were analyzed using GraphPad Prism. The means of the data are displayed as ± SEM. Data for cytokines and antibodies from the different groups were analyzed using ANOVA with Tukey’s post hoc test. Ethical approvalThis study was approved by the Committee of Research Ethics at the College of Veterinary Medicine, University of Al-Qadisiyah, Iraq (2378-22-1-2025). ResultsIdentification and confirmation of Salmonella isolatesEvery single clinical isolate uniquely and classically exhibited Salmonella colony characteristics on XLD, SS, and MacConkey agar by exhibiting the formation of non-lactose fermenting and H2S-positive colonies. In Fall 2021, the biochemistry profiles from the automated charts (Isolate_5120251–5120255) showed glucose fermentation, positive lysine decarboxylase, negative urease, and citrate using Salmonella spp. The molecular verification of these isolates. By retrieving sequences through PCR and aligning the sequences, we confirmed that all isolates clustered together in the phylogenetic tree of the Salmonella clades. The high correlation of the phenotype and genotype in the identification of the isolates in the extracts for the LPS isolation suggested and confirmed that these isolates were/represent a Salmonella lineage for immunological testing and evaluation (Fig. 1).
Fig. 1. Bacterial identification of Salmonella spp. A. Chromogenic agar B. DCA agar C. Xld Agar. D. PCR-electrophoresis based on the 16S rRNA gene All lanes: positive amplification. Sequence alignment and phylogenetic analysisWhile the submitted sequences were aligned, reference datasets showed alignment and conservation in the sequence of major coding with minimal nucleotide variations at non-essential and other regions, indicating substitutions. The image of the aligned sequences showed multiple on the 22 strains strong consistent isolates of the Salmonella demonstrating the strong variation of their sequences and demonstrating the stability of Salmonella isolates. The phylogenetic tree classification showed that all 22 Salmonella strains formed a strong and single monophylactic cluster and major clades in the tree with high bootstrap values of over 90%, demonstrating that all the Salmonella isolates had similar evolutionary diversity. The absence of divergence in their sequences showed that these tissues and the antigenic LPS for Salmonella strains were the best for extractions (Fig. 2).
Fig. 2. Multiple-sequence alignment confirming the genetic similarity of the Salmonella isolates to the reference strains and the phylogenetic tree. Characterization of endotoxins by extraction and SDS-PAGEAn endotoxin fraction devoid of nucleic acid and protein contamination was obtained by hot phenol-water extraction. Using SDS-PAGE silver stain, the presence of strong smoothed ladder patterns consisting of intact O-antigene polysaccharides was visualized. SDS-PAGE analysis indicated smooth-type LPS with unique ladder-like bands with molecular weights between 10 and 70 kDa confirmed with a protein pre-stained ladder. The uploaded gel image provided some evidence of distinct and smooth-type LPS banding. This indicated the successful extraction of O-polysaccharide. The multiplicity of bands seen from the gel was hypothesized to indicate polysaccharides and their preserved LPS structures. The bands shown on the gel were preserved from ever losing their LPS structures. From the high yield, the polysaccharides were presumably intact and were guaranteed to induce a strong immune response during vaccination (Fig. 3).
Fig. 3. SDS-PAGE silver-stained profile showing the smooth-type O-antigen ladder of purified LPS from Salmonella with clear high- and low-molecular-weight band patterns. Cytokine production following LPS vaccinationPost LPS Vaccination, the subjects exhibited significant production of TNF-α (80 pg/ml), IL-6 (70 pg/ml), IL-1β (65 pg/ml), and IFN-γ (60 pg/ml), and the production was significantly greater than that of the control subjects (ranging 20–15 pg/ml). These observations reflect the strong stimulation of TLR4-polarized T-cell pathways and the classical LPS-driven mechanisms of the innate immune system, where LPS is released during the process. The statistically significant production (p < 0.01) from the LPS fraction was shown to induce a strong immune response during the controlled vaccination, suggesting an altered primary immune response (Fig. 3). Production of humoral antibodies (IgM and IgG)Significant elevations in both IgM and IgG levels after LPS vaccination were shown by indirect enzyme-linked immunosorbent assay. In the vaccinated animals, IgM was 0.5 and IgG was 2.0 compared to control animals, which measured 0.1–0.2. The data indicate that the initial B-cell responses (IgM) were followed by class switching to IgG, resulting in strong recognition of the antigen and differentiated adaptive immunity against LPS. Furthermore, the elevated-significant levels of IgG indicate that long-term protective immunity was achieved in the form of circulating antibodies, demonstrating that the purified LPS was immunogenic. The color was developed using a TMB substrate, and the reaction was stopped with sulfuric acid before measuring the absorbance at 450 nm (Figs. 4 and 5).
Fig. 4. Serum TNF-α, IL-6, IL-1β, and IFN-γ levels demonstrating strong cytokine responses after LPS immunization.
Fig. 5. Anti -LPS IgM and IgG absorbance values indicate robust humoral immunity in LPS-vaccinated animals. DiscussionThe current study supports the findings of Shende and Gupta (2022) that purified Salmonella LPS significantly increased TNF-α, IL-6, IL-1β, IFN-γ, and strong IgM/IgG production. Thus, LPS serves as an immunostimulatory molecule that is critical for activation on several levels of the immune response model, to the level of vaccine effectiveness. The findings of this study support the strong cytokine activation identified in Qiao et al. (2021), who showed that bacterial membrane vesicles enriched with LPS stimulated an immune response in the host. This also corresponds to the work of Micoli et al. (2022), who described the immunogenicity of an LPS-containing, GMMA-based vaccine against Shigella. The work on the GMMA vaccine developed to include LPS strongly defends the LPS as an antigen whose presence is required to stimulate and support as a critical component of host defense against many gram-negative pathogens. The patterns on SDS-PAGE illustrating the extraction of the smooth-type LPS serve as confirmation when compared to similar findings on Brucella and Shigella vaccines and support findings from Serpa Gonçalves and Dorneles (2025), which suggest that the morphology of LPS precisely delineates the efficacy of the vaccine and subclaims its smooth-type LPS, which possesses a stronger immunogenic character. Similarly, Qasim et al. (2022) claimed that the subunit vaccine made with intact OMV LPS, whose immunogenicity was associated with the elicitation of protective immunity. The findings of this study on anti-LPS antibody production are, to an extent, comparable to the findings of humoral response indicated by Rabie and Amin Girh (2020), who described the polysaccharide surface of the bacterial extracts as a factor that intensifies the antibody-mediated protective response compared to the inactive whole-cell vaccines. Reflecting on the data interpreted in this study demonstrates the integration of findings from Kato and Kumanogoh (2025) on the activation of the innate immune system. The memory of the innate immune system is formed by the primary exposure to LPS and leads to hyper-responsiveness with greater secondary responses. This result is similar to the significant booster responses observed in our experimental animals. Reports by Swartzwelter et al. (2020) on LPS and nanoparticle exposure demonstrate similar mechanisms, as macrophage activation was robustly potentiated. Citing Romerio and Peri (2020), the data on the increase of IFN-γ aligns perfectly, as this was also observed when TLR4 ligands resembling lipid A were added, resulting in hyper-activated cell-mediated immunity without toxicity. Therefore, the results and relevant literature support the conclusions of this study, which suggest that the immune-boosting effect of Salmonella LPS observed in the present study is not inconsistent with the mechanisms involving TLR4 of innate and trained immune responses. The work’s documented robust overall immunogenicity also corroborates wider evidence in the development of gram-negative vaccines. Mancini et al. (2021) reported that GMMA constructs enriched with LPS produced high antibody titers, similar to what was documented in this case study. The LPS immunostimulatory multitasking capacity was similarly reported, including the Klebsiella surface polysaccharides, LPS, which modulate immune recognition akin to Salmonella, Patro, and Rathinavelan (2019). LPS is also essential for the virulence and immune evasion of Proteus mirabilis. Yang et al. (2024) suggested that LPS-based vaccines combat Thus supporting the view that they present broad immunological coverage. The recognition of LPS-derived molecules as potent adjuvants supports the high cytokine and antibody responses observed in the present study. Hence, these factors suggest that the outcomes of the present study align with the findings of widespread research, just as Kumar et al. (2019) documented LPS as a potent, dependable immunogenic constituent. This justifies LPS-based vaccines as a viable platform for developing next-generation vaccines against various bacterial infections. ConclusionThe results of this research analysis indicate that unmodified pure Salmonella LPS is an extremely effective immunogen that can produce strong innate and adapted immunological responses. The extract produced “unmodified” smooth-type LPS, which, as clinically immunized patients of this cohort demonstrated, produced a remarkable elevation of the prof inflammatory cytokines as well as increased production of IgM antibodies and IgG. The results of this study are consistent and support the evidence of the effectiveness of OMV and LPS-based platforms and demonstrate the potential of LPS to stimulate both immediate and sustained protective responses. Collectively, Salmonella LPS is an excellent immunogen, creating the framework to stimulate protective studies, identify the optimum adjuvant, and discover a multifactorial vaccine. AcknowledgmentThe authors thank the College of Veterinary Medicine, University of Al-Qadisiyah, for their support in this study. Conflict of interestThe authors have no conflicts of interest to declare. FundingThe authors have self-funded the study. No external funding source is available. Authors’ contributionsAll authors have participated in the study. Data availabilityData are available when requested by the corresponding author. ReferencesAsadi Karam, M.R., Habibi, M. and Bouzari, S. 2019. Urinary tract infection: pathogenicity, antibiotic resistance and development of effective vaccines against uropathogenic Escherichia coli. Mol. Immunol. 108, 56–67; doi:10.1016/j.molimm.2019.02.007 Cross, A.S. 2023. Hit 'em where it hurts: gram-negative bacterial lipopolysaccharide as a vaccine target. MicroBiol. Mol. Biol. Rev. 87(3), e00045–e00022; doi:10.1128/mmbr.00045-22 Drummer, C., Saaoud, F., Shao, Y., Sun, Y., Xu, K., Lu, Y., Ni, D., Atar, D., Jiang, X., Wang, H. and Yang, X. 2021. Trained immunity and reactivity of macrophages and endothelial cells. Arteriosclerosis. Thrombosis. Vascular Biol. 41(3), 1032–1046; doi:10.1161/ATVBAHA.120.315452 España, P.P., Uranga, A., Cillóniz, C. and Torres, A. 2020. Q Fever (Coxiella burnetii). Seminars Respiratory Crit. Care Med. 41(4), 509–521; doi:10.1055/s-0040-1710594 Garling, A., Auvray, F., Epardaud, M., Oswald, E. and Branchu, P. 2025. Outer membrane vesicles as a versatile platform for vaccine development: engineering strategies, applications and challenges. J. Extracellular Vesicles 14(9), e70150; doi:10.1002/jev2.70150 Gulati, S., Shaughnessy, J., Ram, S. and Rice, P.A. 2019. Targeting lipooligosaccharide (LOS) for a gonococcal vaccine. Front. Immunol. 10, 321; doi:10.3389/fimmu.2019.00321 Haque, S., Swami, P. and Khan, A. 2021. S. Typhi derived vaccines and proposal for outer membrane vesicles (OMVs) for typhoid fever. Microbial Pathogenesis 158, 105082; doi10.1016/j.micpath.2021.105082 Hulbert, S.W., Desai, P., Jewett, M.C., DeLisa, M.P. and Williams, A.J. 2023. Glycovaccinology: the design and engineering of carbohydrate-based vaccine components. Biotechnol. Adv. 68, 108234; doi: 10.1016/j.biotechadv.2023.108234 Kato, Y. and Kumanogoh, A. 2025. The immune memory of innate immune systems. Int. Immunol. 37(4), 195–202; doi:10.1093/intimm/dxae067 Kumar, S., Sunagar, R. and Gosselin, E. 2019. Bacterial protein Toll-like-receptor agonists: a novel perspective on vaccine adjuvants. Front. Immunol. 10, 1144; doi:10.3389/fimmu.2019.01144 Li, L., Xu, X., Cheng, P., Yu, Z., Li, M., Yu, Z., Cheng, W., Zhang, W., Sun, H. and Song, X. 2025. Klebsiella pneumoniae derived outer membrane vesicles mediated bacterial virulence, antibiotic resistance, host immune responses and clinical applications. Virulence 16(1), 2449722; doi:10.1080/21505594.2025.2449722 Liu, P., Sang, Z., Liu, K., Zhang, M. and Niu, Y. 2025. Mycobacterium tuberculosis Hsp70 as a cancer vaccine adjuvant. Vaccine 62, 127493; doi:10.1016/j.vaccine.2025.127493 Mancini, F., Micoli, F., Necchi, F., Pizza, M., Berlanda Scorza, F. and Rossi, O. 2021. GMMA-Based vaccines: the known and the unknown. Front. Immunol. 12, 715393; doi:10.3389/fimmu.2021.715393 Micoli, F., Nakakana, U.N. and Berlanda Scorza, F. 2022. Towards a four-component GMMA-based vaccine against Shigella. Vaccines 10(2), 328; doi:10.3390/vaccines10020328 Miller, J.C., Cross, A.S., Tennant, S.M. and Baliban, S.M. 2024. Klebsiella pneumoniae lipopolysaccharide as a vaccine target. Vaccines 12(10), 1177; doi:10.3390/vaccines12101177 Mora, V.P., Loaiza, R.A., Soto, J.A., Bohmwald, K. and Kalergis, A.M. 2023. Involvement of trained immunity during autoimmune responses. J. Autoimmunity. 137, 102956; doi:10.1016/j.jaut.2022.102956 Patro, L.P.P. and Rathinavelan, T. 2019. Targeting the sugary armor of Klebsiella species. Front. Cellular Infect Microbiol. 9, 367; doi10.3389/fcimb.2019.00367 Qasim, M., Wrage, M., Nüse, B. and Mattner, J. 2022. Shigella outer membrane vesicles as promising targets for vaccination. Int. J. Mol. Sci. 23(2), 994; doi:10.3390/ijms23020994 Qiao, L., Rao, Y., Zhu, K., Rao, X. and Zhou, R. 2021. Engineered remolding and application of bacterial membrane vesicles. Front. Microbiol. 12, 729369; doi:10.3389/fmicb.2021.729369 Rabie, N.S. and Amin Girh, Z.M.S. 2020. Bacterial vaccines in poultry. Bull. Nat. Res. Centre 44(1), 15; doi:10.1186/s42269-019-0260-1 Roman, F., Burny, W., Ceregido, M.A., Laupèze, B., Temmerman, S.T., Warter, L. and Coccia, M. 2024. Adjuvant system AS01: mode of action to effective vaccines. Expert. Rev. Vaccines. 23(1), 715–729; doi:10.1080/14760584.2024.2382725 Romerio, A. and Peri, F. 2020. Increasing the chemical variety of small-molecule-based TLR4 modulators. Front. Immunol. 11, 1210; doi:10.3389/fimmu.2020.01210 Serpa Gonçalves, M. and Dorneles, E.M.S. 2025. Does lipopolysaccharide morphology of Brucella abortus vaccine strains influence the potency of the vaccine?. Vet. Immunol. 285, 110950; doi:10.1016/j.vetimm.2025.110950 Shende, P. and Gupta, S. 2022. Role of lipopolysaccharides in potential applications of nanocarrier systems. Curr. Pharm. Design. 28(12), 1000–1010; doi:10.2174/1381612827666211124094302 Swartzwelter, B.J., Fux, A.C., Johnson, L., Swart, E., Hofer, S., Hofstätter, N., Geppert, M., Italiani, P., Boraschi, D., Duschl, A. and Himly, M. 2020. The impact of nanoparticles on innate immune activation by live bacteria. Int. J. Mol. Sci. 21(24), 9695; doi:10.3390/ijms21249695 Yadav, K.K. and Awasthi, S. 2023. Childhood pneumonia: what’s unchanged, and what’s new?. Indian J. Pediatrics 90(7), 693–699; doi:10.1007/s12098-023-04628-3 Yang, A., Tian, Y. and Li, X. 2024. Unveiling the hidden arsenal: new insights into Proteus mirabilis virulence in UTIs. Front. Cellular InfectMicrobiol. 14, 1465460; doi:10.3389/fcimb.2024.1465460 Zhu, H., Rollier, C.S. and Pollard, A.J. 2021. Advances in LPS-based glycoconjugate vaccines. Expert Rev. Vaccines 20(12), 1515–1538; doi:10.1080/14760584.2021.1984889 | ||
| How to Cite this Article |
| Pubmed Style Khalaf HA, Abed AA. Assessment of Salmonella spp. Lipopolysaccharide immunogenicity for candidate vaccine development. Open Vet. J.. 2026; 16(4): 2552-2560. doi:10.5455/OVJ.2026.v16.i4.55 Web Style Khalaf HA, Abed AA. Assessment of Salmonella spp. Lipopolysaccharide immunogenicity for candidate vaccine development. https://www.openveterinaryjournal.com/?mno=296943 [Access: June 26, 2026]. doi:10.5455/OVJ.2026.v16.i4.55 AMA (American Medical Association) Style Khalaf HA, Abed AA. Assessment of Salmonella spp. Lipopolysaccharide immunogenicity for candidate vaccine development. Open Vet. J.. 2026; 16(4): 2552-2560. doi:10.5455/OVJ.2026.v16.i4.55 Vancouver/ICMJE Style Khalaf HA, Abed AA. Assessment of Salmonella spp. Lipopolysaccharide immunogenicity for candidate vaccine development. Open Vet. J.. (2026), [cited June 26, 2026]; 16(4): 2552-2560. doi:10.5455/OVJ.2026.v16.i4.55 Harvard Style Khalaf, H. A. & Abed, . A. A. (2026) Assessment of Salmonella spp. Lipopolysaccharide immunogenicity for candidate vaccine development. Open Vet. J., 16 (4), 2552-2560. doi:10.5455/OVJ.2026.v16.i4.55 Turabian Style Khalaf, Husain Ali, and Alaa Abdulaziz Abed. 2026. Assessment of Salmonella spp. Lipopolysaccharide immunogenicity for candidate vaccine development. Open Veterinary Journal, 16 (4), 2552-2560. doi:10.5455/OVJ.2026.v16.i4.55 Chicago Style Khalaf, Husain Ali, and Alaa Abdulaziz Abed. "Assessment of Salmonella spp. Lipopolysaccharide immunogenicity for candidate vaccine development." Open Veterinary Journal 16 (2026), 2552-2560. doi:10.5455/OVJ.2026.v16.i4.55 MLA (The Modern Language Association) Style Khalaf, Husain Ali, and Alaa Abdulaziz Abed. "Assessment of Salmonella spp. Lipopolysaccharide immunogenicity for candidate vaccine development." Open Veterinary Journal 16.4 (2026), 2552-2560. Print. doi:10.5455/OVJ.2026.v16.i4.55 APA (American Psychological Association) Style Khalaf, H. A. & Abed, . A. A. (2026) Assessment of Salmonella spp. Lipopolysaccharide immunogenicity for candidate vaccine development. Open Veterinary Journal, 16 (4), 2552-2560. doi:10.5455/OVJ.2026.v16.i4.55 |